Review



algorithms graphpad prism  (Tree Star Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Tree Star Inc algorithms graphpad prism
    Algorithms Graphpad Prism, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/flowjo10/pm42268710-553-201-212
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Software:

    Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii.
    Article Snippet: .. This paper N/A Software and algorithms GraphPad Prism version 9.5.1 GraphPad https://www.graphpad.com/ R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/downloads QuantStudioTM Design & Analysis Software Thermo Fisher https://www.thermofisher.cn/cn/zh/home/technical- resources/software-downloads/quantstudio-3-5real-time-pcr-systems.html Fiji Schindelin et al.34 https://imagej.net/software/fiji/downloads Other LSM 980 Confocal Microscope Zeiss LSM 980 BD LSR II flow cytometer BD biosciences N/A SapphireTM Biomolecular Imager Azure Biosystems N/A Cell Reports 45, 117424, June 23, 2026 13 ..

    Article Title: Glutathione is critical for NK cell-mediated immunity.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms FlowJo Software 10.10 Tree Star RRID:SCR_008520 Graphpad Prism 10 GraphPad Software, Inc RRID:SCR_002798 BioRender.com BioRender RRID:SCR_018361 SoftMax Pro7.1 Molecular Devices RRID:SCR_014240 Inkscape 1.3 Inkscape Developers RRID:SCR_014479 Salmon – RRID:SCR_017036 DESeq2 – RRID:SCR_015687 .. BioNavigator 63 Pamgene N/A 18 Cell Reports 45, 116986, March 24, 2026 infected mice, the plaque forming assay unit assay was performed as previously described.

    Article Title: Neuroanatomical organization of electroacupuncture in modulating gastric function in mice and humans.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-ChAT Millipore Cat#AB144P; RRID: AB_2079751 Rabbit polyclonal anti-dsRed Takara Cat# 632496; RRID: AB_10013483 Rabbit monoclonal anti-Tuj1 Abcam Cat# AB 52623; RRID: AB_869991 Goat polyclonal anti-nNos Abcam Cat# AB1376; RRID: AB_300614 Rabbit polyclonal anti-Fluro-gold Millipore Cat# AB153-I; RRID: AB_2632408 Rabbit polyclonal anti-GFP Thermo Fisher Scientific Cat# A11122; RRID: AB_221569 Chicken anti-GFP Thermo Fisher Scientific Cat# A10262; RRID: AB_2534023 Rabbit anti-TRPV1 Alomone labs Cat# ACC-030; RRID: AB_2313819 Donkey polyclonal secondary anti-rabbit Alexa 488 Jackson ImmunoResearch Cat# 711-545-152; RRID: AB_2313584 Donkey anti-goat Alexa 594 Jackson ImmunoResearch Cat# 705-585-003; RRID: AB_2340432 Donkey anti-goat Alexa 488 Jackson ImmunoResearch Cat# 705-545-003; RRID: AB_2340428 Donkey anti-rabbit Alexa 405 Jackson ImmunoResearch Cat# 711-475-152; RRID: AB_2340616 Donkey polyclonal anti-rabbit Alexa 594 Jackson ImmunoResearch Cat# 711-585-152; RRID: AB_2340621 Donkey polyclonal anti-chicken Alexa 488 Jackson ImmunoResearch Cat# 703-545-155; RRID: AB_2340375 Donkey polyclonal anti-rabbit Cy3 Jackson ImmunoResearch Cat# 711-165-152; RRID: AB_2307443 Donkey anti-goat FITC Jackson ImmunoResearch Cat# 705-095-147; RRID: AB_2340401 Bacterial and virus strains rAAV-EF1α-DIO-GCaMp6m Brain VTA Cat# PT-0106 rAAV-EF1α-fDIO-tdTomato Brain VTA Cat# PT-0147 HSV-ΔTK-LSL-tdTomato-2A-TK Brain VTA Cat# H02003 Chemicals, peptides, and recombinant proteins 4-Hydroxytamoxifen Sigma Cat# H6278 Capsaicin Tocris Cat# 0462 QX-314 Sigma Cat# L5783 LPS Sigma Cat# L2630 Fluoro-gold Fluorochrome Cat# NC1363013 Cisplatin Sigma Cat# C2210000 Meloxicam Sigma Cat# PHR1799 GastroSense 750 Fluorescence probe PerkinElmer Cat# NEV11121 DTX Sigma Cat# D0564 Deposited data Raw data from RNA sequencing Gene Expression Omnibus GEO: GSE300772 Critical commercial assays TNF-α ELISA kit Thermofisher Cat# BMS607 IL-6 ELISA kit R&D Systems Cat# M6000B RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Bio Cat# 323100 RNAscope Probe- Mm-Pdyn-C2 ACD Bio Cat# 318771-C2 RNAscope Probe- Mm-Oxtr-C3 ACD Bio Cat# 412171-C3 RNAscope Probe- Mm-Chat-C2 ACD Bio Cat# 408731-C2 RNAscop Probe- Mm-Trpv1-C2 ACD Bio Cat# 313331-C2 RNAscop Probe- Mm-Adra2a-C3 ACD Bio Cat# 425341-C3 RNAscop Probe- Mm-Cck-C3 ACD Bio Cat# 402271-C3 (Continued on next page) e1 Neuron 113, 3243–3259.e1–e11, October 1, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNAscop Probe- EGFP-O4 ACD Bio Cat# 538851 RNAscope Probe- tdTomato ACD Bio Cat# 317041 Experimental models: Organisms/strains Mouse: C57BL/6JGpt The GemPharmatech N000013 Mouse: Chat FlpO : B6.CgChat tm1.1(flpo)Rmcld /J The Jackson Laboratory JAX: 036281 Mouse: Fos-CreER: B6.129(Cg) Fos tm1.1(cre/ERT2)Luo /J The Jackson Laboratory JAX: 021882 Mouse: LSL-H2B-EGFP: B6.Cg-Gt(ROSA) 26Sor tm8(CAG-HIST1H2BB/EGFP)Zjh /J The Jackson Laboratory JAX: 036761 Mouse: TRPV1-Cre: B6.129Trpv1 tm1(cre)Bbm /J The Jackson Laboratory JAX: 017769 Mouse: Oxtr-T2A-Cre: B6.CgOxtr tm1.1(cre)Hze /J The Jackson Laboratory JAX: 031303 Mouse: ChAT-Cre: B6;129S6Chat tm2(cre)Lowl /J The Jackson Laboratory JAX: 006410 Mouse: Ai80 (RCFL-CatCh): B6.Cg-Gt(ROSA) 26Sor tm80.1(CAG-COP4*L132C/EYFP)Hze /J The Jackson Laboratory JAX: 025109 Mouse: Ai195: B6;129S6Igs7 tm195(tetO-GCaMP7s,CAG-tTA2)Tasic /J The Jackson Laboratory JAX: 034112 Mouse: Trpv1-DTR-EGFP This study N/A Mouse: Trpv1-ChR2-EGFP This study N/A Mouse: R26-e(CAG-LSL-FSF-tdTomato2A-DTR-Wpre-pA) This study N/A Software and algorithms GraphPad Prism 8.0 GraphPad https://www.graphpad.com/scientific- software/prism/ Living Image PerkinElmer https://www.revvity.cn/software- downloads/in-vivo-imaging ImageJ National Institute of Health https://imagej.net/ij/ R Robert Gentleman and Ross Ihaka https://www.r-project.org/ Seurat 5.1.0 Seurat V5 https://satijalab.org/seurat/ G*Power University of Dusseldorf https://www.gpower.hhu.de/ FlowJo v10.4 Tree Star https://www.flowjo.com/solutions/flowjo LabChart 8 AD Instruments https://www.adinstruments.com.cn/ products/labchart/versions-and-licenses SPSS 29 IBM https://www.ibm.com/support/pages/ downloading-ibm-spss-statistics-29 Other Anesthesia apparatus Shanghai Kuo Yun Instruments Co. KY-G40 Millar pressure catheter AD Instruments SPR-671 PowerLab 8/35 AD Instruments PL3508 Bridge Amp AD Instruments FE221 Spirometer AD Instruments FE141 Dual Bio Amp AD Instruments FE232 Electric stimulator A-M Systems Model 3800 Isolator A-M Systems Model 3820 Laser stimulation system THINKERTECH QAXK-LASER-B1 Micropump RWD R-480 (Continued on next page) Neuron 113, 3243–3259.e1–e11, October 1, 2025 e2 ..

    Article Title: Pharmacologic glycoengineering of Fcγ receptor IIIa enhances force-resistant IgG-FcγR interactions and anti-tumor antibody efficacy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PNPP Substrates Thermo Scientific Cat#34047 Diethanolamine Substrate Buffer Pierce Cat#34064 Matrigel Matrix Corning Cat#356230 LudgerTag PROC Glycan Labeling Kit Ludger Ltd. Cat#LT-KPROC-24 D-Luciferin, Potassium Salt Goldbio Cat# LUCK-1G Critical commercial assays CellTiter-Glo assay Promega Cat#G7571 Experimental models: Cell lines Human: Expi293 Expression System ThermoFisher Scientific Cat#A14635 Mouse: EL4-hCD20 mouse lymphoma, overexpressing human CD20 Modified in House N/A Mouse: B16F10 mouse melanoma ATCC Cat#CRL-6475 Mouse: Hepa 1-6 mouse hepatoma ATCC Cat#CRL-1830 Mouse: MC38 murine colon adenocarcinoma Millipore Sigma Cat#SCC172 Experimental models: Organisms/strains Mouse: FcγR-humanized C57BL/6 that express human CD20 (hFcγR/hCD20) In-house N/A Mouse: hFcγR/hCD20 without FcγRIIIa (hFcγR/hCD20/FcγRIIIaKO) In-house N/A Oligonucleotides .. Recombinant DNA Plasmid: anti-CD20 hIgG1 monoclonal (clone rituximab) Dr. J. Ravetch N/A Plasmid: anti-CD4 hIgG1 monoclonal (clone YTS191) Dr. S. Bournazos N/A Plasmid: anti-CD25 hIgG1 monoclonal (clone PC-61, with G236A mutation) Dr. R. Dehan N/A Plasmid: human recombinant FcγRIIIa Produced in-house pSC-sfGFP-oriFCGR3A Software and algorithms FlowJo v 10.9.0 Tree Star https://www.flowjo.com/flowjo/download Prism v10 GraphPad Software http://www.graphpad.com/ MultiQuant 2.1.1 SCIEX https://sciex.com/products/software/ multiquant-software Byonic software Protein Metrics Inc. RRID: SCR_016735 Xcalibur 4.5 Thermo Fisher Scientific https://www.thermofisher.com/order/ catalog/product/OPTON-30965 nanoLC-4000 QTRAP platform SCIEX https://sciex.com/products/mass- spectrometers/qtrap-systems/qtrap-4000system SimGlycan PREMIER Biosoft https://www.premierbiosoft.com/glycan/ index.html Other Lithium Heparin-treated tubes BD Biosciences Cat#365985 Plate flow chamber with gasket B (flow width: 0.25cm, gasket thickness: 0.0254cm) Glycotech Cat#1188-31-001 Syringe pump AL-1000 World Precision Instrument Aladdin Cat#NC1881156 SepMateTM-50 StemCell Technologies Cat#3502254199 e3 Immunity 59, 1–11.e1–e7, July 14, 2026 ..

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    Article Title: ΔNp73 isoform defines a TP53-mutant-like poor-risk subgroup of acute myeloid leukemia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMVIL3,CSF2,KITLG)1Eav/MloySzJ (NSGS mice) The Jackon Laboratory RRID: IMSR_JAX:013062 C;129S4-Rag2tm1.1Flv Csf1tm1(CSF1)Flv Csf2/Il3tm1.1(CSF2,IL3)Flv Thpotm1.1(TPO)Flv Il2rgtm1.1Flv Tg(SIRPA)1Flv/J (MISTRG mice) University of Zurich and University Hospital Zurich Prof. Markus G Manz RRID: IMSR_JAX:017712 Oligonucleotides gRNA primers for intragenic TP73 region knockout Table S6 – cDNA primers for gene expression analysis Table S6 – ChIP-qPCR primers Table S6 – Recombinant DNA pCMV-TurboGFP_shCEBPA SMARTvector Lentiviral shRNA (plasmid) Dharmacon reagents V3SH11240-224846075 pMSCV-EGFP-Puro-ΔNp73α/ΔNp73β (plasmid) Lucena-Araujo et al.56 GFP fusion for ΔNp73 isoforms Software and algorithms FlowJo v10.0.6 Treestar http://www.flowjo.com/RRID:SCR_008520 Prism 9 GraphPad http://www.graphpad.com/ SPSS Statistical package 19.1 IBM https://www.ibm.com/ RStudio CRAN www.r-project.org GSEA 4.0.1 Broad Institute https://software.broadinstitute.org/gsea/ RRID:SCR_003199 Single sample gene set enrichment analysis (ssGSEA) Barbie et al.57 https://www.genepattern.org/modules/ docs/ssGSEAProjection/4#gsc.tab=0 WashU Epigenome Browser Li et al.58 https://epigenomegateway.wustl.edu/ browser/RRID:SCR_006208 Elysium Lachmann et al.59 https://maayanlab.cloud/cloudalignment/ elysium.html Morpheus Broad Institute https://software.broadinstitute.org/morpheus RRID:SCR_014975 Cytoscape 3.10.2 – http://apps.cytoscape.org/apps/bingo RRID:SCR_003032 Synergy finder Ianeviski et al.60 https://synergyfinder.fimm.fi/ Bowtie v2.3.1 Langmead and Salzberg et al.61 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml RRID:SCR_016368 MACS v1.4.2 Zhang et al.62 http://liulab.dfci.harvard.edu/MACS/ RRID:SCR_013291 Adobe Illustrator Adobe https://www.adobe.com/nl/RRID:SCR_010279 JBrowse2 JBrowse https://jbrowse.org/jb2/RRID:SCR_001004 Connectivity Map – Clue Broad Institute https://clue.io/RRID:SCR_015674 e4 Cell Reports Medicine 7, 102540, January 20, 2026 OPEN ACCESS were pre-stimulated with StemlineII medium (SigmaAldrich; #S0192), 1% penicillin/streptomycin (PS) supplemented with SCF (255-SC, Novus Biologicals), FLT3 ligand (FLT3-L, Amgen) and N-plate (TPO) (Amgen) (all 100 ng/mL). .. PBMSC CD34+ cells were pre-stimulated with StemlineII, 1% PS, 20% fetal bovine serum (FBS) along with SCF, FLT3-L, N-plate (all 100 ng/mL) and IL-3 (Sandoz) and IL-6 (both 20 ng/mL).

    Microscopy:

    Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii.
    Article Snippet: .. This paper N/A Software and algorithms GraphPad Prism version 9.5.1 GraphPad https://www.graphpad.com/ R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/downloads QuantStudioTM Design & Analysis Software Thermo Fisher https://www.thermofisher.cn/cn/zh/home/technical- resources/software-downloads/quantstudio-3-5real-time-pcr-systems.html Fiji Schindelin et al.34 https://imagej.net/software/fiji/downloads Other LSM 980 Confocal Microscope Zeiss LSM 980 BD LSR II flow cytometer BD biosciences N/A SapphireTM Biomolecular Imager Azure Biosystems N/A Cell Reports 45, 117424, June 23, 2026 13 ..

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    Flow Cytometry:

    Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii.
    Article Snippet: .. This paper N/A Software and algorithms GraphPad Prism version 9.5.1 GraphPad https://www.graphpad.com/ R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/downloads QuantStudioTM Design & Analysis Software Thermo Fisher https://www.thermofisher.cn/cn/zh/home/technical- resources/software-downloads/quantstudio-3-5real-time-pcr-systems.html Fiji Schindelin et al.34 https://imagej.net/software/fiji/downloads Other LSM 980 Confocal Microscope Zeiss LSM 980 BD LSR II flow cytometer BD biosciences N/A SapphireTM Biomolecular Imager Azure Biosystems N/A Cell Reports 45, 117424, June 23, 2026 13 ..

    RNAscope:

    Article Title: Neuroanatomical organization of electroacupuncture in modulating gastric function in mice and humans.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-ChAT Millipore Cat#AB144P; RRID: AB_2079751 Rabbit polyclonal anti-dsRed Takara Cat# 632496; RRID: AB_10013483 Rabbit monoclonal anti-Tuj1 Abcam Cat# AB 52623; RRID: AB_869991 Goat polyclonal anti-nNos Abcam Cat# AB1376; RRID: AB_300614 Rabbit polyclonal anti-Fluro-gold Millipore Cat# AB153-I; RRID: AB_2632408 Rabbit polyclonal anti-GFP Thermo Fisher Scientific Cat# A11122; RRID: AB_221569 Chicken anti-GFP Thermo Fisher Scientific Cat# A10262; RRID: AB_2534023 Rabbit anti-TRPV1 Alomone labs Cat# ACC-030; RRID: AB_2313819 Donkey polyclonal secondary anti-rabbit Alexa 488 Jackson ImmunoResearch Cat# 711-545-152; RRID: AB_2313584 Donkey anti-goat Alexa 594 Jackson ImmunoResearch Cat# 705-585-003; RRID: AB_2340432 Donkey anti-goat Alexa 488 Jackson ImmunoResearch Cat# 705-545-003; RRID: AB_2340428 Donkey anti-rabbit Alexa 405 Jackson ImmunoResearch Cat# 711-475-152; RRID: AB_2340616 Donkey polyclonal anti-rabbit Alexa 594 Jackson ImmunoResearch Cat# 711-585-152; RRID: AB_2340621 Donkey polyclonal anti-chicken Alexa 488 Jackson ImmunoResearch Cat# 703-545-155; RRID: AB_2340375 Donkey polyclonal anti-rabbit Cy3 Jackson ImmunoResearch Cat# 711-165-152; RRID: AB_2307443 Donkey anti-goat FITC Jackson ImmunoResearch Cat# 705-095-147; RRID: AB_2340401 Bacterial and virus strains rAAV-EF1α-DIO-GCaMp6m Brain VTA Cat# PT-0106 rAAV-EF1α-fDIO-tdTomato Brain VTA Cat# PT-0147 HSV-ΔTK-LSL-tdTomato-2A-TK Brain VTA Cat# H02003 Chemicals, peptides, and recombinant proteins 4-Hydroxytamoxifen Sigma Cat# H6278 Capsaicin Tocris Cat# 0462 QX-314 Sigma Cat# L5783 LPS Sigma Cat# L2630 Fluoro-gold Fluorochrome Cat# NC1363013 Cisplatin Sigma Cat# C2210000 Meloxicam Sigma Cat# PHR1799 GastroSense 750 Fluorescence probe PerkinElmer Cat# NEV11121 DTX Sigma Cat# D0564 Deposited data Raw data from RNA sequencing Gene Expression Omnibus GEO: GSE300772 Critical commercial assays TNF-α ELISA kit Thermofisher Cat# BMS607 IL-6 ELISA kit R&D Systems Cat# M6000B RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Bio Cat# 323100 RNAscope Probe- Mm-Pdyn-C2 ACD Bio Cat# 318771-C2 RNAscope Probe- Mm-Oxtr-C3 ACD Bio Cat# 412171-C3 RNAscope Probe- Mm-Chat-C2 ACD Bio Cat# 408731-C2 RNAscop Probe- Mm-Trpv1-C2 ACD Bio Cat# 313331-C2 RNAscop Probe- Mm-Adra2a-C3 ACD Bio Cat# 425341-C3 RNAscop Probe- Mm-Cck-C3 ACD Bio Cat# 402271-C3 (Continued on next page) e1 Neuron 113, 3243–3259.e1–e11, October 1, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNAscop Probe- EGFP-O4 ACD Bio Cat# 538851 RNAscope Probe- tdTomato ACD Bio Cat# 317041 Experimental models: Organisms/strains Mouse: C57BL/6JGpt The GemPharmatech N000013 Mouse: Chat FlpO : B6.CgChat tm1.1(flpo)Rmcld /J The Jackson Laboratory JAX: 036281 Mouse: Fos-CreER: B6.129(Cg) Fos tm1.1(cre/ERT2)Luo /J The Jackson Laboratory JAX: 021882 Mouse: LSL-H2B-EGFP: B6.Cg-Gt(ROSA) 26Sor tm8(CAG-HIST1H2BB/EGFP)Zjh /J The Jackson Laboratory JAX: 036761 Mouse: TRPV1-Cre: B6.129Trpv1 tm1(cre)Bbm /J The Jackson Laboratory JAX: 017769 Mouse: Oxtr-T2A-Cre: B6.CgOxtr tm1.1(cre)Hze /J The Jackson Laboratory JAX: 031303 Mouse: ChAT-Cre: B6;129S6Chat tm2(cre)Lowl /J The Jackson Laboratory JAX: 006410 Mouse: Ai80 (RCFL-CatCh): B6.Cg-Gt(ROSA) 26Sor tm80.1(CAG-COP4*L132C/EYFP)Hze /J The Jackson Laboratory JAX: 025109 Mouse: Ai195: B6;129S6Igs7 tm195(tetO-GCaMP7s,CAG-tTA2)Tasic /J The Jackson Laboratory JAX: 034112 Mouse: Trpv1-DTR-EGFP This study N/A Mouse: Trpv1-ChR2-EGFP This study N/A Mouse: R26-e(CAG-LSL-FSF-tdTomato2A-DTR-Wpre-pA) This study N/A Software and algorithms GraphPad Prism 8.0 GraphPad https://www.graphpad.com/scientific- software/prism/ Living Image PerkinElmer https://www.revvity.cn/software- downloads/in-vivo-imaging ImageJ National Institute of Health https://imagej.net/ij/ R Robert Gentleman and Ross Ihaka https://www.r-project.org/ Seurat 5.1.0 Seurat V5 https://satijalab.org/seurat/ G*Power University of Dusseldorf https://www.gpower.hhu.de/ FlowJo v10.4 Tree Star https://www.flowjo.com/solutions/flowjo LabChart 8 AD Instruments https://www.adinstruments.com.cn/ products/labchart/versions-and-licenses SPSS 29 IBM https://www.ibm.com/support/pages/ downloading-ibm-spss-statistics-29 Other Anesthesia apparatus Shanghai Kuo Yun Instruments Co. KY-G40 Millar pressure catheter AD Instruments SPR-671 PowerLab 8/35 AD Instruments PL3508 Bridge Amp AD Instruments FE221 Spirometer AD Instruments FE141 Dual Bio Amp AD Instruments FE232 Electric stimulator A-M Systems Model 3800 Isolator A-M Systems Model 3820 Laser stimulation system THINKERTECH QAXK-LASER-B1 Micropump RWD R-480 (Continued on next page) Neuron 113, 3243–3259.e1–e11, October 1, 2025 e2 ..

    SPR Assay:

    Article Title: Neuroanatomical organization of electroacupuncture in modulating gastric function in mice and humans.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat polyclonal anti-ChAT Millipore Cat#AB144P; RRID: AB_2079751 Rabbit polyclonal anti-dsRed Takara Cat# 632496; RRID: AB_10013483 Rabbit monoclonal anti-Tuj1 Abcam Cat# AB 52623; RRID: AB_869991 Goat polyclonal anti-nNos Abcam Cat# AB1376; RRID: AB_300614 Rabbit polyclonal anti-Fluro-gold Millipore Cat# AB153-I; RRID: AB_2632408 Rabbit polyclonal anti-GFP Thermo Fisher Scientific Cat# A11122; RRID: AB_221569 Chicken anti-GFP Thermo Fisher Scientific Cat# A10262; RRID: AB_2534023 Rabbit anti-TRPV1 Alomone labs Cat# ACC-030; RRID: AB_2313819 Donkey polyclonal secondary anti-rabbit Alexa 488 Jackson ImmunoResearch Cat# 711-545-152; RRID: AB_2313584 Donkey anti-goat Alexa 594 Jackson ImmunoResearch Cat# 705-585-003; RRID: AB_2340432 Donkey anti-goat Alexa 488 Jackson ImmunoResearch Cat# 705-545-003; RRID: AB_2340428 Donkey anti-rabbit Alexa 405 Jackson ImmunoResearch Cat# 711-475-152; RRID: AB_2340616 Donkey polyclonal anti-rabbit Alexa 594 Jackson ImmunoResearch Cat# 711-585-152; RRID: AB_2340621 Donkey polyclonal anti-chicken Alexa 488 Jackson ImmunoResearch Cat# 703-545-155; RRID: AB_2340375 Donkey polyclonal anti-rabbit Cy3 Jackson ImmunoResearch Cat# 711-165-152; RRID: AB_2307443 Donkey anti-goat FITC Jackson ImmunoResearch Cat# 705-095-147; RRID: AB_2340401 Bacterial and virus strains rAAV-EF1α-DIO-GCaMp6m Brain VTA Cat# PT-0106 rAAV-EF1α-fDIO-tdTomato Brain VTA Cat# PT-0147 HSV-ΔTK-LSL-tdTomato-2A-TK Brain VTA Cat# H02003 Chemicals, peptides, and recombinant proteins 4-Hydroxytamoxifen Sigma Cat# H6278 Capsaicin Tocris Cat# 0462 QX-314 Sigma Cat# L5783 LPS Sigma Cat# L2630 Fluoro-gold Fluorochrome Cat# NC1363013 Cisplatin Sigma Cat# C2210000 Meloxicam Sigma Cat# PHR1799 GastroSense 750 Fluorescence probe PerkinElmer Cat# NEV11121 DTX Sigma Cat# D0564 Deposited data Raw data from RNA sequencing Gene Expression Omnibus GEO: GSE300772 Critical commercial assays TNF-α ELISA kit Thermofisher Cat# BMS607 IL-6 ELISA kit R&D Systems Cat# M6000B RNAscope Multiplex Fluorescent Reagent Kit v2 ACD Bio Cat# 323100 RNAscope Probe- Mm-Pdyn-C2 ACD Bio Cat# 318771-C2 RNAscope Probe- Mm-Oxtr-C3 ACD Bio Cat# 412171-C3 RNAscope Probe- Mm-Chat-C2 ACD Bio Cat# 408731-C2 RNAscop Probe- Mm-Trpv1-C2 ACD Bio Cat# 313331-C2 RNAscop Probe- Mm-Adra2a-C3 ACD Bio Cat# 425341-C3 RNAscop Probe- Mm-Cck-C3 ACD Bio Cat# 402271-C3 (Continued on next page) e1 Neuron 113, 3243–3259.e1–e11, October 1, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNAscop Probe- EGFP-O4 ACD Bio Cat# 538851 RNAscope Probe- tdTomato ACD Bio Cat# 317041 Experimental models: Organisms/strains Mouse: C57BL/6JGpt The GemPharmatech N000013 Mouse: Chat FlpO : B6.CgChat tm1.1(flpo)Rmcld /J The Jackson Laboratory JAX: 036281 Mouse: Fos-CreER: B6.129(Cg) Fos tm1.1(cre/ERT2)Luo /J The Jackson Laboratory JAX: 021882 Mouse: LSL-H2B-EGFP: B6.Cg-Gt(ROSA) 26Sor tm8(CAG-HIST1H2BB/EGFP)Zjh /J The Jackson Laboratory JAX: 036761 Mouse: TRPV1-Cre: B6.129Trpv1 tm1(cre)Bbm /J The Jackson Laboratory JAX: 017769 Mouse: Oxtr-T2A-Cre: B6.CgOxtr tm1.1(cre)Hze /J The Jackson Laboratory JAX: 031303 Mouse: ChAT-Cre: B6;129S6Chat tm2(cre)Lowl /J The Jackson Laboratory JAX: 006410 Mouse: Ai80 (RCFL-CatCh): B6.Cg-Gt(ROSA) 26Sor tm80.1(CAG-COP4*L132C/EYFP)Hze /J The Jackson Laboratory JAX: 025109 Mouse: Ai195: B6;129S6Igs7 tm195(tetO-GCaMP7s,CAG-tTA2)Tasic /J The Jackson Laboratory JAX: 034112 Mouse: Trpv1-DTR-EGFP This study N/A Mouse: Trpv1-ChR2-EGFP This study N/A Mouse: R26-e(CAG-LSL-FSF-tdTomato2A-DTR-Wpre-pA) This study N/A Software and algorithms GraphPad Prism 8.0 GraphPad https://www.graphpad.com/scientific- software/prism/ Living Image PerkinElmer https://www.revvity.cn/software- downloads/in-vivo-imaging ImageJ National Institute of Health https://imagej.net/ij/ R Robert Gentleman and Ross Ihaka https://www.r-project.org/ Seurat 5.1.0 Seurat V5 https://satijalab.org/seurat/ G*Power University of Dusseldorf https://www.gpower.hhu.de/ FlowJo v10.4 Tree Star https://www.flowjo.com/solutions/flowjo LabChart 8 AD Instruments https://www.adinstruments.com.cn/ products/labchart/versions-and-licenses SPSS 29 IBM https://www.ibm.com/support/pages/ downloading-ibm-spss-statistics-29 Other Anesthesia apparatus Shanghai Kuo Yun Instruments Co. KY-G40 Millar pressure catheter AD Instruments SPR-671 PowerLab 8/35 AD Instruments PL3508 Bridge Amp AD Instruments FE221 Spirometer AD Instruments FE141 Dual Bio Amp AD Instruments FE232 Electric stimulator A-M Systems Model 3800 Isolator A-M Systems Model 3820 Laser stimulation system THINKERTECH QAXK-LASER-B1 Micropump RWD R-480 (Continued on next page) Neuron 113, 3243–3259.e1–e11, October 1, 2025 e2 ..

    Recombinant:

    Article Title: Pharmacologic glycoengineering of Fcγ receptor IIIa enhances force-resistant IgG-FcγR interactions and anti-tumor antibody efficacy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PNPP Substrates Thermo Scientific Cat#34047 Diethanolamine Substrate Buffer Pierce Cat#34064 Matrigel Matrix Corning Cat#356230 LudgerTag PROC Glycan Labeling Kit Ludger Ltd. Cat#LT-KPROC-24 D-Luciferin, Potassium Salt Goldbio Cat# LUCK-1G Critical commercial assays CellTiter-Glo assay Promega Cat#G7571 Experimental models: Cell lines Human: Expi293 Expression System ThermoFisher Scientific Cat#A14635 Mouse: EL4-hCD20 mouse lymphoma, overexpressing human CD20 Modified in House N/A Mouse: B16F10 mouse melanoma ATCC Cat#CRL-6475 Mouse: Hepa 1-6 mouse hepatoma ATCC Cat#CRL-1830 Mouse: MC38 murine colon adenocarcinoma Millipore Sigma Cat#SCC172 Experimental models: Organisms/strains Mouse: FcγR-humanized C57BL/6 that express human CD20 (hFcγR/hCD20) In-house N/A Mouse: hFcγR/hCD20 without FcγRIIIa (hFcγR/hCD20/FcγRIIIaKO) In-house N/A Oligonucleotides .. Recombinant DNA Plasmid: anti-CD20 hIgG1 monoclonal (clone rituximab) Dr. J. Ravetch N/A Plasmid: anti-CD4 hIgG1 monoclonal (clone YTS191) Dr. S. Bournazos N/A Plasmid: anti-CD25 hIgG1 monoclonal (clone PC-61, with G236A mutation) Dr. R. Dehan N/A Plasmid: human recombinant FcγRIIIa Produced in-house pSC-sfGFP-oriFCGR3A Software and algorithms FlowJo v 10.9.0 Tree Star https://www.flowjo.com/flowjo/download Prism v10 GraphPad Software http://www.graphpad.com/ MultiQuant 2.1.1 SCIEX https://sciex.com/products/software/ multiquant-software Byonic software Protein Metrics Inc. RRID: SCR_016735 Xcalibur 4.5 Thermo Fisher Scientific https://www.thermofisher.com/order/ catalog/product/OPTON-30965 nanoLC-4000 QTRAP platform SCIEX https://sciex.com/products/mass- spectrometers/qtrap-systems/qtrap-4000system SimGlycan PREMIER Biosoft https://www.premierbiosoft.com/glycan/ index.html Other Lithium Heparin-treated tubes BD Biosciences Cat#365985 Plate flow chamber with gasket B (flow width: 0.25cm, gasket thickness: 0.0254cm) Glycotech Cat#1188-31-001 Syringe pump AL-1000 World Precision Instrument Aladdin Cat#NC1881156 SepMateTM-50 StemCell Technologies Cat#3502254199 e3 Immunity 59, 1–11.e1–e7, July 14, 2026 ..

    Article Title: ΔNp73 isoform defines a TP53-mutant-like poor-risk subgroup of acute myeloid leukemia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMVIL3,CSF2,KITLG)1Eav/MloySzJ (NSGS mice) The Jackon Laboratory RRID: IMSR_JAX:013062 C;129S4-Rag2tm1.1Flv Csf1tm1(CSF1)Flv Csf2/Il3tm1.1(CSF2,IL3)Flv Thpotm1.1(TPO)Flv Il2rgtm1.1Flv Tg(SIRPA)1Flv/J (MISTRG mice) University of Zurich and University Hospital Zurich Prof. Markus G Manz RRID: IMSR_JAX:017712 Oligonucleotides gRNA primers for intragenic TP73 region knockout Table S6 – cDNA primers for gene expression analysis Table S6 – ChIP-qPCR primers Table S6 – Recombinant DNA pCMV-TurboGFP_shCEBPA SMARTvector Lentiviral shRNA (plasmid) Dharmacon reagents V3SH11240-224846075 pMSCV-EGFP-Puro-ΔNp73α/ΔNp73β (plasmid) Lucena-Araujo et al.56 GFP fusion for ΔNp73 isoforms Software and algorithms FlowJo v10.0.6 Treestar http://www.flowjo.com/RRID:SCR_008520 Prism 9 GraphPad http://www.graphpad.com/ SPSS Statistical package 19.1 IBM https://www.ibm.com/ RStudio CRAN www.r-project.org GSEA 4.0.1 Broad Institute https://software.broadinstitute.org/gsea/ RRID:SCR_003199 Single sample gene set enrichment analysis (ssGSEA) Barbie et al.57 https://www.genepattern.org/modules/ docs/ssGSEAProjection/4#gsc.tab=0 WashU Epigenome Browser Li et al.58 https://epigenomegateway.wustl.edu/ browser/RRID:SCR_006208 Elysium Lachmann et al.59 https://maayanlab.cloud/cloudalignment/ elysium.html Morpheus Broad Institute https://software.broadinstitute.org/morpheus RRID:SCR_014975 Cytoscape 3.10.2 – http://apps.cytoscape.org/apps/bingo RRID:SCR_003032 Synergy finder Ianeviski et al.60 https://synergyfinder.fimm.fi/ Bowtie v2.3.1 Langmead and Salzberg et al.61 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml RRID:SCR_016368 MACS v1.4.2 Zhang et al.62 http://liulab.dfci.harvard.edu/MACS/ RRID:SCR_013291 Adobe Illustrator Adobe https://www.adobe.com/nl/RRID:SCR_010279 JBrowse2 JBrowse https://jbrowse.org/jb2/RRID:SCR_001004 Connectivity Map – Clue Broad Institute https://clue.io/RRID:SCR_015674 e4 Cell Reports Medicine 7, 102540, January 20, 2026 OPEN ACCESS were pre-stimulated with StemlineII medium (SigmaAldrich; #S0192), 1% penicillin/streptomycin (PS) supplemented with SCF (255-SC, Novus Biologicals), FLT3 ligand (FLT3-L, Amgen) and N-plate (TPO) (Amgen) (all 100 ng/mL). .. PBMSC CD34+ cells were pre-stimulated with StemlineII, 1% PS, 20% fetal bovine serum (FBS) along with SCF, FLT3-L, N-plate (all 100 ng/mL) and IL-3 (Sandoz) and IL-6 (both 20 ng/mL).

    Plasmid Preparation:

    Article Title: Pharmacologic glycoengineering of Fcγ receptor IIIa enhances force-resistant IgG-FcγR interactions and anti-tumor antibody efficacy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PNPP Substrates Thermo Scientific Cat#34047 Diethanolamine Substrate Buffer Pierce Cat#34064 Matrigel Matrix Corning Cat#356230 LudgerTag PROC Glycan Labeling Kit Ludger Ltd. Cat#LT-KPROC-24 D-Luciferin, Potassium Salt Goldbio Cat# LUCK-1G Critical commercial assays CellTiter-Glo assay Promega Cat#G7571 Experimental models: Cell lines Human: Expi293 Expression System ThermoFisher Scientific Cat#A14635 Mouse: EL4-hCD20 mouse lymphoma, overexpressing human CD20 Modified in House N/A Mouse: B16F10 mouse melanoma ATCC Cat#CRL-6475 Mouse: Hepa 1-6 mouse hepatoma ATCC Cat#CRL-1830 Mouse: MC38 murine colon adenocarcinoma Millipore Sigma Cat#SCC172 Experimental models: Organisms/strains Mouse: FcγR-humanized C57BL/6 that express human CD20 (hFcγR/hCD20) In-house N/A Mouse: hFcγR/hCD20 without FcγRIIIa (hFcγR/hCD20/FcγRIIIaKO) In-house N/A Oligonucleotides .. Recombinant DNA Plasmid: anti-CD20 hIgG1 monoclonal (clone rituximab) Dr. J. Ravetch N/A Plasmid: anti-CD4 hIgG1 monoclonal (clone YTS191) Dr. S. Bournazos N/A Plasmid: anti-CD25 hIgG1 monoclonal (clone PC-61, with G236A mutation) Dr. R. Dehan N/A Plasmid: human recombinant FcγRIIIa Produced in-house pSC-sfGFP-oriFCGR3A Software and algorithms FlowJo v 10.9.0 Tree Star https://www.flowjo.com/flowjo/download Prism v10 GraphPad Software http://www.graphpad.com/ MultiQuant 2.1.1 SCIEX https://sciex.com/products/software/ multiquant-software Byonic software Protein Metrics Inc. RRID: SCR_016735 Xcalibur 4.5 Thermo Fisher Scientific https://www.thermofisher.com/order/ catalog/product/OPTON-30965 nanoLC-4000 QTRAP platform SCIEX https://sciex.com/products/mass- spectrometers/qtrap-systems/qtrap-4000system SimGlycan PREMIER Biosoft https://www.premierbiosoft.com/glycan/ index.html Other Lithium Heparin-treated tubes BD Biosciences Cat#365985 Plate flow chamber with gasket B (flow width: 0.25cm, gasket thickness: 0.0254cm) Glycotech Cat#1188-31-001 Syringe pump AL-1000 World Precision Instrument Aladdin Cat#NC1881156 SepMateTM-50 StemCell Technologies Cat#3502254199 e3 Immunity 59, 1–11.e1–e7, July 14, 2026 ..

    Article Title: ΔNp73 isoform defines a TP53-mutant-like poor-risk subgroup of acute myeloid leukemia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMVIL3,CSF2,KITLG)1Eav/MloySzJ (NSGS mice) The Jackon Laboratory RRID: IMSR_JAX:013062 C;129S4-Rag2tm1.1Flv Csf1tm1(CSF1)Flv Csf2/Il3tm1.1(CSF2,IL3)Flv Thpotm1.1(TPO)Flv Il2rgtm1.1Flv Tg(SIRPA)1Flv/J (MISTRG mice) University of Zurich and University Hospital Zurich Prof. Markus G Manz RRID: IMSR_JAX:017712 Oligonucleotides gRNA primers for intragenic TP73 region knockout Table S6 – cDNA primers for gene expression analysis Table S6 – ChIP-qPCR primers Table S6 – Recombinant DNA pCMV-TurboGFP_shCEBPA SMARTvector Lentiviral shRNA (plasmid) Dharmacon reagents V3SH11240-224846075 pMSCV-EGFP-Puro-ΔNp73α/ΔNp73β (plasmid) Lucena-Araujo et al.56 GFP fusion for ΔNp73 isoforms Software and algorithms FlowJo v10.0.6 Treestar http://www.flowjo.com/RRID:SCR_008520 Prism 9 GraphPad http://www.graphpad.com/ SPSS Statistical package 19.1 IBM https://www.ibm.com/ RStudio CRAN www.r-project.org GSEA 4.0.1 Broad Institute https://software.broadinstitute.org/gsea/ RRID:SCR_003199 Single sample gene set enrichment analysis (ssGSEA) Barbie et al.57 https://www.genepattern.org/modules/ docs/ssGSEAProjection/4#gsc.tab=0 WashU Epigenome Browser Li et al.58 https://epigenomegateway.wustl.edu/ browser/RRID:SCR_006208 Elysium Lachmann et al.59 https://maayanlab.cloud/cloudalignment/ elysium.html Morpheus Broad Institute https://software.broadinstitute.org/morpheus RRID:SCR_014975 Cytoscape 3.10.2 – http://apps.cytoscape.org/apps/bingo RRID:SCR_003032 Synergy finder Ianeviski et al.60 https://synergyfinder.fimm.fi/ Bowtie v2.3.1 Langmead and Salzberg et al.61 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml RRID:SCR_016368 MACS v1.4.2 Zhang et al.62 http://liulab.dfci.harvard.edu/MACS/ RRID:SCR_013291 Adobe Illustrator Adobe https://www.adobe.com/nl/RRID:SCR_010279 JBrowse2 JBrowse https://jbrowse.org/jb2/RRID:SCR_001004 Connectivity Map – Clue Broad Institute https://clue.io/RRID:SCR_015674 e4 Cell Reports Medicine 7, 102540, January 20, 2026 OPEN ACCESS were pre-stimulated with StemlineII medium (SigmaAldrich; #S0192), 1% penicillin/streptomycin (PS) supplemented with SCF (255-SC, Novus Biologicals), FLT3 ligand (FLT3-L, Amgen) and N-plate (TPO) (Amgen) (all 100 ng/mL). .. PBMSC CD34+ cells were pre-stimulated with StemlineII, 1% PS, 20% fetal bovine serum (FBS) along with SCF, FLT3-L, N-plate (all 100 ng/mL) and IL-3 (Sandoz) and IL-6 (both 20 ng/mL).

    Mutagenesis:

    Article Title: Pharmacologic glycoengineering of Fcγ receptor IIIa enhances force-resistant IgG-FcγR interactions and anti-tumor antibody efficacy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PNPP Substrates Thermo Scientific Cat#34047 Diethanolamine Substrate Buffer Pierce Cat#34064 Matrigel Matrix Corning Cat#356230 LudgerTag PROC Glycan Labeling Kit Ludger Ltd. Cat#LT-KPROC-24 D-Luciferin, Potassium Salt Goldbio Cat# LUCK-1G Critical commercial assays CellTiter-Glo assay Promega Cat#G7571 Experimental models: Cell lines Human: Expi293 Expression System ThermoFisher Scientific Cat#A14635 Mouse: EL4-hCD20 mouse lymphoma, overexpressing human CD20 Modified in House N/A Mouse: B16F10 mouse melanoma ATCC Cat#CRL-6475 Mouse: Hepa 1-6 mouse hepatoma ATCC Cat#CRL-1830 Mouse: MC38 murine colon adenocarcinoma Millipore Sigma Cat#SCC172 Experimental models: Organisms/strains Mouse: FcγR-humanized C57BL/6 that express human CD20 (hFcγR/hCD20) In-house N/A Mouse: hFcγR/hCD20 without FcγRIIIa (hFcγR/hCD20/FcγRIIIaKO) In-house N/A Oligonucleotides .. Recombinant DNA Plasmid: anti-CD20 hIgG1 monoclonal (clone rituximab) Dr. J. Ravetch N/A Plasmid: anti-CD4 hIgG1 monoclonal (clone YTS191) Dr. S. Bournazos N/A Plasmid: anti-CD25 hIgG1 monoclonal (clone PC-61, with G236A mutation) Dr. R. Dehan N/A Plasmid: human recombinant FcγRIIIa Produced in-house pSC-sfGFP-oriFCGR3A Software and algorithms FlowJo v 10.9.0 Tree Star https://www.flowjo.com/flowjo/download Prism v10 GraphPad Software http://www.graphpad.com/ MultiQuant 2.1.1 SCIEX https://sciex.com/products/software/ multiquant-software Byonic software Protein Metrics Inc. RRID: SCR_016735 Xcalibur 4.5 Thermo Fisher Scientific https://www.thermofisher.com/order/ catalog/product/OPTON-30965 nanoLC-4000 QTRAP platform SCIEX https://sciex.com/products/mass- spectrometers/qtrap-systems/qtrap-4000system SimGlycan PREMIER Biosoft https://www.premierbiosoft.com/glycan/ index.html Other Lithium Heparin-treated tubes BD Biosciences Cat#365985 Plate flow chamber with gasket B (flow width: 0.25cm, gasket thickness: 0.0254cm) Glycotech Cat#1188-31-001 Syringe pump AL-1000 World Precision Instrument Aladdin Cat#NC1881156 SepMateTM-50 StemCell Technologies Cat#3502254199 e3 Immunity 59, 1–11.e1–e7, July 14, 2026 ..

    Produced:

    Article Title: Pharmacologic glycoengineering of Fcγ receptor IIIa enhances force-resistant IgG-FcγR interactions and anti-tumor antibody efficacy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PNPP Substrates Thermo Scientific Cat#34047 Diethanolamine Substrate Buffer Pierce Cat#34064 Matrigel Matrix Corning Cat#356230 LudgerTag PROC Glycan Labeling Kit Ludger Ltd. Cat#LT-KPROC-24 D-Luciferin, Potassium Salt Goldbio Cat# LUCK-1G Critical commercial assays CellTiter-Glo assay Promega Cat#G7571 Experimental models: Cell lines Human: Expi293 Expression System ThermoFisher Scientific Cat#A14635 Mouse: EL4-hCD20 mouse lymphoma, overexpressing human CD20 Modified in House N/A Mouse: B16F10 mouse melanoma ATCC Cat#CRL-6475 Mouse: Hepa 1-6 mouse hepatoma ATCC Cat#CRL-1830 Mouse: MC38 murine colon adenocarcinoma Millipore Sigma Cat#SCC172 Experimental models: Organisms/strains Mouse: FcγR-humanized C57BL/6 that express human CD20 (hFcγR/hCD20) In-house N/A Mouse: hFcγR/hCD20 without FcγRIIIa (hFcγR/hCD20/FcγRIIIaKO) In-house N/A Oligonucleotides .. Recombinant DNA Plasmid: anti-CD20 hIgG1 monoclonal (clone rituximab) Dr. J. Ravetch N/A Plasmid: anti-CD4 hIgG1 monoclonal (clone YTS191) Dr. S. Bournazos N/A Plasmid: anti-CD25 hIgG1 monoclonal (clone PC-61, with G236A mutation) Dr. R. Dehan N/A Plasmid: human recombinant FcγRIIIa Produced in-house pSC-sfGFP-oriFCGR3A Software and algorithms FlowJo v 10.9.0 Tree Star https://www.flowjo.com/flowjo/download Prism v10 GraphPad Software http://www.graphpad.com/ MultiQuant 2.1.1 SCIEX https://sciex.com/products/software/ multiquant-software Byonic software Protein Metrics Inc. RRID: SCR_016735 Xcalibur 4.5 Thermo Fisher Scientific https://www.thermofisher.com/order/ catalog/product/OPTON-30965 nanoLC-4000 QTRAP platform SCIEX https://sciex.com/products/mass- spectrometers/qtrap-systems/qtrap-4000system SimGlycan PREMIER Biosoft https://www.premierbiosoft.com/glycan/ index.html Other Lithium Heparin-treated tubes BD Biosciences Cat#365985 Plate flow chamber with gasket B (flow width: 0.25cm, gasket thickness: 0.0254cm) Glycotech Cat#1188-31-001 Syringe pump AL-1000 World Precision Instrument Aladdin Cat#NC1881156 SepMateTM-50 StemCell Technologies Cat#3502254199 e3 Immunity 59, 1–11.e1–e7, July 14, 2026 ..

    Membrane:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    CCK-8 Assay:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    Imaging:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    BIA-KA:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    ATP Assay:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    RNA Sequencing:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    Gene Expression:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    Article Title: ΔNp73 isoform defines a TP53-mutant-like poor-risk subgroup of acute myeloid leukemia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMVIL3,CSF2,KITLG)1Eav/MloySzJ (NSGS mice) The Jackon Laboratory RRID: IMSR_JAX:013062 C;129S4-Rag2tm1.1Flv Csf1tm1(CSF1)Flv Csf2/Il3tm1.1(CSF2,IL3)Flv Thpotm1.1(TPO)Flv Il2rgtm1.1Flv Tg(SIRPA)1Flv/J (MISTRG mice) University of Zurich and University Hospital Zurich Prof. Markus G Manz RRID: IMSR_JAX:017712 Oligonucleotides gRNA primers for intragenic TP73 region knockout Table S6 – cDNA primers for gene expression analysis Table S6 – ChIP-qPCR primers Table S6 – Recombinant DNA pCMV-TurboGFP_shCEBPA SMARTvector Lentiviral shRNA (plasmid) Dharmacon reagents V3SH11240-224846075 pMSCV-EGFP-Puro-ΔNp73α/ΔNp73β (plasmid) Lucena-Araujo et al.56 GFP fusion for ΔNp73 isoforms Software and algorithms FlowJo v10.0.6 Treestar http://www.flowjo.com/RRID:SCR_008520 Prism 9 GraphPad http://www.graphpad.com/ SPSS Statistical package 19.1 IBM https://www.ibm.com/ RStudio CRAN www.r-project.org GSEA 4.0.1 Broad Institute https://software.broadinstitute.org/gsea/ RRID:SCR_003199 Single sample gene set enrichment analysis (ssGSEA) Barbie et al.57 https://www.genepattern.org/modules/ docs/ssGSEAProjection/4#gsc.tab=0 WashU Epigenome Browser Li et al.58 https://epigenomegateway.wustl.edu/ browser/RRID:SCR_006208 Elysium Lachmann et al.59 https://maayanlab.cloud/cloudalignment/ elysium.html Morpheus Broad Institute https://software.broadinstitute.org/morpheus RRID:SCR_014975 Cytoscape 3.10.2 – http://apps.cytoscape.org/apps/bingo RRID:SCR_003032 Synergy finder Ianeviski et al.60 https://synergyfinder.fimm.fi/ Bowtie v2.3.1 Langmead and Salzberg et al.61 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml RRID:SCR_016368 MACS v1.4.2 Zhang et al.62 http://liulab.dfci.harvard.edu/MACS/ RRID:SCR_013291 Adobe Illustrator Adobe https://www.adobe.com/nl/RRID:SCR_010279 JBrowse2 JBrowse https://jbrowse.org/jb2/RRID:SCR_001004 Connectivity Map – Clue Broad Institute https://clue.io/RRID:SCR_015674 e4 Cell Reports Medicine 7, 102540, January 20, 2026 OPEN ACCESS were pre-stimulated with StemlineII medium (SigmaAldrich; #S0192), 1% penicillin/streptomycin (PS) supplemented with SCF (255-SC, Novus Biologicals), FLT3 ligand (FLT3-L, Amgen) and N-plate (TPO) (Amgen) (all 100 ng/mL). .. PBMSC CD34+ cells were pre-stimulated with StemlineII, 1% PS, 20% fetal bovine serum (FBS) along with SCF, FLT3-L, N-plate (all 100 ng/mL) and IL-3 (Sandoz) and IL-6 (both 20 ng/mL).

    Sequencing:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    Transmission Assay:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    Electron Microscopy:

    Article Title: Acutely denervated muscle EVs reshape neuronal mitochondrial metabolism via retrograde signaling to rescue peripheral nerve injury.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays PKH26 Red Fluorescent Cell Linker Mini Kit Sigma-Aldrich Cat# AE20204M Mitochondrial membrane potential assay kit with JC-1 Beyotime Cat# C2006 CCK-8 Assay Kit Dojindo Laboratories Cat# CK04 LIVE/DEAD Cell Imaging Kit Thermo Fisher Scientific Cat# R37601 NADP+/NADPH detection kit Beyotime Cat# S0179 NAD+/NADH detection kit Beyotime Cat# S0175 BCA assay kit Beyotime Cat# P0010 Enhanced ATP Assay Kit Beyotime Cat# S0027 GelMA Hydrogel Engineering for life Cat#EFL-GM-60 Deposited data RNA-seq data This study GEO: GSE312514, GEO: GSE312113 RNA-seq data Gene Expression Omnibus GEO: GSE44259 Metabolomics data This study MTBLS13442 Proteomics sequencing data This study PXD071459 Experimental models: Organisms/strains Mouse: C57BL/6 Fourth Military Medical University N/A Rat: SD (Sprague-Dawley) Fourth Military Medical University N/A Software and algorithms ImageJ software NIH https://imagej.nih.gov/ij/ GraphPad Prism 9.0 GraphPad https://www.graphpad-prism.cn/ R Studio R Studio https://rstudio.com Adobe Illustrator Adobe N/A BL-420 N bio-signal acquisition system Chengdu Taimeng N/A FlowJo 10.8 TreeStar N/A Illumina NovaSeq 6000 sequencing Illumina https://www.illumina.com.cn/ systems/sequencing-pl atforms/novaseq.html Zen blue (version 3.5) Zeiss https://www.zeiss.com/ corporate/en/home.html Other Transmission electron microscopy HITACHI HT7800 Laser-scanning confocal microscope Zeiss Zeiss LSM 900, Germany Tissue-Tek O.C.T. .. Compound Sakura Finetek Cat#4583 FV31S-DT software Olympus N/A CatWalk XT Noldus N/A Seahorse XFe96 Extracellular Flux Analyzer Agilentek N/A Nanoparticle Tracking Analysis System (ZetaView) Particle Metrix GmbH, Germany N/A IVIS Spectrum imaging system PerkinElmer N/A Cell Reports Medicine 7, 102585, February 17, 2026 e2 Article ll OPEN ACCESS All experiments were conducted with simple randomization performed by an independent researcher prior to the experiments.

    other:

    Article Title: Glycolysis inhibition functionally reprograms T follicular helper cells and reverses lupus.
    Article Snippet: Cat#15062 NAD/NADH-Glo TM kit Promega Cat#G9071 RNeasy Plus Micro Kit Qiagen Cat#74034 TruSeq Stranded RNA Sample Preparation Kit Illumina Cat#20020596 AMPure XP beads Beckman Coulter Cat#A63880 Quant-iT TM PicoGreen TM dsDNA assay ThermoFisher Cat#P7589 Qick-DNA Microprep Plus kit Zymo Research Cat#D4074 Next Enzymatic Methyl-seq Kit NEB Cat#E7120 Fixation/Permeabilization kit eBioscience Cat#00-5123-43 CD4 T cell Isolation Kit Miltenyi Biotec Cat#130-104-454 B Cell Isolation Kit Miltenyi Biotec Cat#130-090-862 Pierce BCA protein assay kit ThermoFisher Cat#23225 4 - 20% SDS-PAGE gels BioRad Cat#4561094 Kallestad HEp-2 BioRad Cat#26101 Deposited data Murine Tfh cell RNASeq dataset and DNA bisulfite sequencing dataset NCBI BioProject PRJNA1089578 human Tfh cell RNASeq dataset NCBI BioProject PRJNA1089580 Untargeted metabolomics analysis of murine Tfh cells National Metabolomics Data Repository ST004242 Untargeted metabolomics analysis of human Tfh cells National Metabolomics Data Repository ST004243 Experimental models: Organisms/strains B6.NZM-Sle1 NZM2410/Aeg Sle2 NZM2410/Aeg Sle3 NZM2410/Aeg /LmoJ (TC) female mice Jackson Laboratory RRID:IMSR_JAX:007228 C57BL6/J mice Jackson Laboratory RRID:IMSR_JAX:000664 NZW/J female mice Jackson Laboratory RRID:IMSR_JAX:001058 BXSB/MpJ male mice Jackson Laboratory RRID:IMSR_JAX:000740 WYaa male mice This paper B6.Cg-Sle1 NZM2410/Aeg Yaa/DcrJ Jackson Laboratory RRID:IMSR_JAX:021569 Software and algorithms FlowJo V10 Tree Star https://www.flowjo.com/solutions/flowjo/downloads Prism Graphpad https://www.graphpad.com/scientific-software/prism/ ImageJ NIH https://imagej.nih.gov/ij/ Metamorph Molecular Devices https://www.moleculardevices.com/products/ cellular-imaging-systems/high-contentanalysis/metamorph-microscopy STAR aligner v2.7 Open source https://github.com/alexdobin/STAR FeatureCounts (v2.0) Bioconductor https://subread.sourceforge.net/featureCounts.html DESeq2 Bioconductor https://bioconductor.org/packages/ release/bioc/html/DESeq2.html pheatmap R function (version 1.0.12) Datacamp https://www.rdocumentation.org/packages/ pheatmap/versions/1.0.12 Matplotlib-Venn (Version 0.11.5) MIT https://www.piwheels.org/project/matplotlib-venn/ Bismark v0.22.3 Babraham Institute https://www.bioinformatics.babraham.ac.uk/ projects/bismark/ DSS Ge et al. 84 https://www.bioconductor.org/packages/ release/bioc/html/DSS.html BEDTools v2.29.2 Ge et al. 84 https://bedtools.readthedocs.io/en/latest/ DAVID NCI https://david.ncifcrf.gov 20 Cell Reports 44, 116600, December 23, 2025

    Article Title: STING-OPTN signaling confers cytoprotection through TBK1-dependent mitophagy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER YPH mito-keima Dr. Richard J. Youle N/A HEK293T stably expressing YFP-Parkin Dr. Han-Ming Shen N/A SH-SY5Y ATCC Cat#CRL-2266; RRID:CVCL_0019 Oligonucleotides siRNA targeting cGAS Purchased from Integrated DNA Technologies (IDT) Design ID: hs.Ri.MB21D1.13 siRNA targeting TBK1 Purchased from Integrated DNA Technologies (IDT) Design ID: hs.Ri.TBK1.13 siRNA targeting STING #1: AGCATTACAACAACCTGCT Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting STING #2: CGAACTTACAATCAGCATT Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting OPTN: CCACCAGCTGAAAGAAGCC Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting PINK1 Purchased from Invitrogen Cat#1299001 siRNA targeting sequence: VCP #1: CAGUGUUGCUGAAAGGAAAGA UUUCCUUUCAGCAACACUGUG Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting sequence: VCP #2: GCAGCUAGCUCAGAUCAAAGA UUUGAUCUGAGCUAGCUGCUU Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting sequence: VCP #3: GCAAGAAGAUGGAUCUCAUUG AUGAGAUCCAUCUUCUUGCGG Synthesized by Tsingke Biotechnology (Beijing, China) N/A Recombinant DNA lentiCRISPR v2 Dr. Feng Zhang Addgene plasmid # 52961; RRID:Addgene_52961 Lentiguide V2-sgcGAS Dr. James Chen N/A Lentiguide V2-sgSTING Dr. James Chen N/A Lentiguide V2-sgTBK1 Dr. James Chen N/A pCDNA4-TREX1-WT-3XFLAG This paper N/A pCDNA4-PINK1-WT-3XFLAG This paper N/A pCDNA4-PINK1-E240K-3XFLAG This paper N/A pCDNA4-PINK1-G309D-3XFLAG This paper N/A Parkin-WT-FLAG Dr. Liming Wang N/A Parkin-S65A-FLAG Dr. Liming Wang N/A OPTN-FLAG Dr. Qiming Sun N/A TBK1-FLAG Dr. Wei Wan N/A Software and algorithms GraphPad Prism (https://www.graphpad. com/features) GraphPad Software Version 8.0 FlowJo (https://www.flowjo.com/) Tree Star Software Version 10.0 Adobe Illustrator (http://www.adobe.com/ cn/) Adobe Systems Version 26.0 ImageJ (https://imagej.nih.gov/ij/) Java Version 1.8.0 Other 1 × PBS BioChannel Biological Technology Co., Ltd. Cat#BC-BPBS-01 not-fat milk Biosharp Cat#BS102-500g Protease Inhibitor Cocktail TargetMol Cat#C0001-1 mL Phosphatase Inhibitor Cocktail III TargetMol Cat#C0004-2 mL Stripping Buffer CWBIO Cat#CW0056 Cell Reports 45, 117515, June 23, 2026 19

    Knock-Out:

    Article Title: ΔNp73 isoform defines a TP53-mutant-like poor-risk subgroup of acute myeloid leukemia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMVIL3,CSF2,KITLG)1Eav/MloySzJ (NSGS mice) The Jackon Laboratory RRID: IMSR_JAX:013062 C;129S4-Rag2tm1.1Flv Csf1tm1(CSF1)Flv Csf2/Il3tm1.1(CSF2,IL3)Flv Thpotm1.1(TPO)Flv Il2rgtm1.1Flv Tg(SIRPA)1Flv/J (MISTRG mice) University of Zurich and University Hospital Zurich Prof. Markus G Manz RRID: IMSR_JAX:017712 Oligonucleotides gRNA primers for intragenic TP73 region knockout Table S6 – cDNA primers for gene expression analysis Table S6 – ChIP-qPCR primers Table S6 – Recombinant DNA pCMV-TurboGFP_shCEBPA SMARTvector Lentiviral shRNA (plasmid) Dharmacon reagents V3SH11240-224846075 pMSCV-EGFP-Puro-ΔNp73α/ΔNp73β (plasmid) Lucena-Araujo et al.56 GFP fusion for ΔNp73 isoforms Software and algorithms FlowJo v10.0.6 Treestar http://www.flowjo.com/RRID:SCR_008520 Prism 9 GraphPad http://www.graphpad.com/ SPSS Statistical package 19.1 IBM https://www.ibm.com/ RStudio CRAN www.r-project.org GSEA 4.0.1 Broad Institute https://software.broadinstitute.org/gsea/ RRID:SCR_003199 Single sample gene set enrichment analysis (ssGSEA) Barbie et al.57 https://www.genepattern.org/modules/ docs/ssGSEAProjection/4#gsc.tab=0 WashU Epigenome Browser Li et al.58 https://epigenomegateway.wustl.edu/ browser/RRID:SCR_006208 Elysium Lachmann et al.59 https://maayanlab.cloud/cloudalignment/ elysium.html Morpheus Broad Institute https://software.broadinstitute.org/morpheus RRID:SCR_014975 Cytoscape 3.10.2 – http://apps.cytoscape.org/apps/bingo RRID:SCR_003032 Synergy finder Ianeviski et al.60 https://synergyfinder.fimm.fi/ Bowtie v2.3.1 Langmead and Salzberg et al.61 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml RRID:SCR_016368 MACS v1.4.2 Zhang et al.62 http://liulab.dfci.harvard.edu/MACS/ RRID:SCR_013291 Adobe Illustrator Adobe https://www.adobe.com/nl/RRID:SCR_010279 JBrowse2 JBrowse https://jbrowse.org/jb2/RRID:SCR_001004 Connectivity Map – Clue Broad Institute https://clue.io/RRID:SCR_015674 e4 Cell Reports Medicine 7, 102540, January 20, 2026 OPEN ACCESS were pre-stimulated with StemlineII medium (SigmaAldrich; #S0192), 1% penicillin/streptomycin (PS) supplemented with SCF (255-SC, Novus Biologicals), FLT3 ligand (FLT3-L, Amgen) and N-plate (TPO) (Amgen) (all 100 ng/mL). .. PBMSC CD34+ cells were pre-stimulated with StemlineII, 1% PS, 20% fetal bovine serum (FBS) along with SCF, FLT3-L, N-plate (all 100 ng/mL) and IL-3 (Sandoz) and IL-6 (both 20 ng/mL).

    ChIP-qPCR:

    Article Title: ΔNp73 isoform defines a TP53-mutant-like poor-risk subgroup of acute myeloid leukemia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMVIL3,CSF2,KITLG)1Eav/MloySzJ (NSGS mice) The Jackon Laboratory RRID: IMSR_JAX:013062 C;129S4-Rag2tm1.1Flv Csf1tm1(CSF1)Flv Csf2/Il3tm1.1(CSF2,IL3)Flv Thpotm1.1(TPO)Flv Il2rgtm1.1Flv Tg(SIRPA)1Flv/J (MISTRG mice) University of Zurich and University Hospital Zurich Prof. Markus G Manz RRID: IMSR_JAX:017712 Oligonucleotides gRNA primers for intragenic TP73 region knockout Table S6 – cDNA primers for gene expression analysis Table S6 – ChIP-qPCR primers Table S6 – Recombinant DNA pCMV-TurboGFP_shCEBPA SMARTvector Lentiviral shRNA (plasmid) Dharmacon reagents V3SH11240-224846075 pMSCV-EGFP-Puro-ΔNp73α/ΔNp73β (plasmid) Lucena-Araujo et al.56 GFP fusion for ΔNp73 isoforms Software and algorithms FlowJo v10.0.6 Treestar http://www.flowjo.com/RRID:SCR_008520 Prism 9 GraphPad http://www.graphpad.com/ SPSS Statistical package 19.1 IBM https://www.ibm.com/ RStudio CRAN www.r-project.org GSEA 4.0.1 Broad Institute https://software.broadinstitute.org/gsea/ RRID:SCR_003199 Single sample gene set enrichment analysis (ssGSEA) Barbie et al.57 https://www.genepattern.org/modules/ docs/ssGSEAProjection/4#gsc.tab=0 WashU Epigenome Browser Li et al.58 https://epigenomegateway.wustl.edu/ browser/RRID:SCR_006208 Elysium Lachmann et al.59 https://maayanlab.cloud/cloudalignment/ elysium.html Morpheus Broad Institute https://software.broadinstitute.org/morpheus RRID:SCR_014975 Cytoscape 3.10.2 – http://apps.cytoscape.org/apps/bingo RRID:SCR_003032 Synergy finder Ianeviski et al.60 https://synergyfinder.fimm.fi/ Bowtie v2.3.1 Langmead and Salzberg et al.61 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml RRID:SCR_016368 MACS v1.4.2 Zhang et al.62 http://liulab.dfci.harvard.edu/MACS/ RRID:SCR_013291 Adobe Illustrator Adobe https://www.adobe.com/nl/RRID:SCR_010279 JBrowse2 JBrowse https://jbrowse.org/jb2/RRID:SCR_001004 Connectivity Map – Clue Broad Institute https://clue.io/RRID:SCR_015674 e4 Cell Reports Medicine 7, 102540, January 20, 2026 OPEN ACCESS were pre-stimulated with StemlineII medium (SigmaAldrich; #S0192), 1% penicillin/streptomycin (PS) supplemented with SCF (255-SC, Novus Biologicals), FLT3 ligand (FLT3-L, Amgen) and N-plate (TPO) (Amgen) (all 100 ng/mL). .. PBMSC CD34+ cells were pre-stimulated with StemlineII, 1% PS, 20% fetal bovine serum (FBS) along with SCF, FLT3-L, N-plate (all 100 ng/mL) and IL-3 (Sandoz) and IL-6 (both 20 ng/mL).

    shRNA:

    Article Title: ΔNp73 isoform defines a TP53-mutant-like poor-risk subgroup of acute myeloid leukemia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMVIL3,CSF2,KITLG)1Eav/MloySzJ (NSGS mice) The Jackon Laboratory RRID: IMSR_JAX:013062 C;129S4-Rag2tm1.1Flv Csf1tm1(CSF1)Flv Csf2/Il3tm1.1(CSF2,IL3)Flv Thpotm1.1(TPO)Flv Il2rgtm1.1Flv Tg(SIRPA)1Flv/J (MISTRG mice) University of Zurich and University Hospital Zurich Prof. Markus G Manz RRID: IMSR_JAX:017712 Oligonucleotides gRNA primers for intragenic TP73 region knockout Table S6 – cDNA primers for gene expression analysis Table S6 – ChIP-qPCR primers Table S6 – Recombinant DNA pCMV-TurboGFP_shCEBPA SMARTvector Lentiviral shRNA (plasmid) Dharmacon reagents V3SH11240-224846075 pMSCV-EGFP-Puro-ΔNp73α/ΔNp73β (plasmid) Lucena-Araujo et al.56 GFP fusion for ΔNp73 isoforms Software and algorithms FlowJo v10.0.6 Treestar http://www.flowjo.com/RRID:SCR_008520 Prism 9 GraphPad http://www.graphpad.com/ SPSS Statistical package 19.1 IBM https://www.ibm.com/ RStudio CRAN www.r-project.org GSEA 4.0.1 Broad Institute https://software.broadinstitute.org/gsea/ RRID:SCR_003199 Single sample gene set enrichment analysis (ssGSEA) Barbie et al.57 https://www.genepattern.org/modules/ docs/ssGSEAProjection/4#gsc.tab=0 WashU Epigenome Browser Li et al.58 https://epigenomegateway.wustl.edu/ browser/RRID:SCR_006208 Elysium Lachmann et al.59 https://maayanlab.cloud/cloudalignment/ elysium.html Morpheus Broad Institute https://software.broadinstitute.org/morpheus RRID:SCR_014975 Cytoscape 3.10.2 – http://apps.cytoscape.org/apps/bingo RRID:SCR_003032 Synergy finder Ianeviski et al.60 https://synergyfinder.fimm.fi/ Bowtie v2.3.1 Langmead and Salzberg et al.61 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml RRID:SCR_016368 MACS v1.4.2 Zhang et al.62 http://liulab.dfci.harvard.edu/MACS/ RRID:SCR_013291 Adobe Illustrator Adobe https://www.adobe.com/nl/RRID:SCR_010279 JBrowse2 JBrowse https://jbrowse.org/jb2/RRID:SCR_001004 Connectivity Map – Clue Broad Institute https://clue.io/RRID:SCR_015674 e4 Cell Reports Medicine 7, 102540, January 20, 2026 OPEN ACCESS were pre-stimulated with StemlineII medium (SigmaAldrich; #S0192), 1% penicillin/streptomycin (PS) supplemented with SCF (255-SC, Novus Biologicals), FLT3 ligand (FLT3-L, Amgen) and N-plate (TPO) (Amgen) (all 100 ng/mL). .. PBMSC CD34+ cells were pre-stimulated with StemlineII, 1% PS, 20% fetal bovine serum (FBS) along with SCF, FLT3-L, N-plate (all 100 ng/mL) and IL-3 (Sandoz) and IL-6 (both 20 ng/mL).

    Magnetic Cell Separation:

    Article Title: ΔNp73 isoform defines a TP53-mutant-like poor-risk subgroup of acute myeloid leukemia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMVIL3,CSF2,KITLG)1Eav/MloySzJ (NSGS mice) The Jackon Laboratory RRID: IMSR_JAX:013062 C;129S4-Rag2tm1.1Flv Csf1tm1(CSF1)Flv Csf2/Il3tm1.1(CSF2,IL3)Flv Thpotm1.1(TPO)Flv Il2rgtm1.1Flv Tg(SIRPA)1Flv/J (MISTRG mice) University of Zurich and University Hospital Zurich Prof. Markus G Manz RRID: IMSR_JAX:017712 Oligonucleotides gRNA primers for intragenic TP73 region knockout Table S6 – cDNA primers for gene expression analysis Table S6 – ChIP-qPCR primers Table S6 – Recombinant DNA pCMV-TurboGFP_shCEBPA SMARTvector Lentiviral shRNA (plasmid) Dharmacon reagents V3SH11240-224846075 pMSCV-EGFP-Puro-ΔNp73α/ΔNp73β (plasmid) Lucena-Araujo et al.56 GFP fusion for ΔNp73 isoforms Software and algorithms FlowJo v10.0.6 Treestar http://www.flowjo.com/RRID:SCR_008520 Prism 9 GraphPad http://www.graphpad.com/ SPSS Statistical package 19.1 IBM https://www.ibm.com/ RStudio CRAN www.r-project.org GSEA 4.0.1 Broad Institute https://software.broadinstitute.org/gsea/ RRID:SCR_003199 Single sample gene set enrichment analysis (ssGSEA) Barbie et al.57 https://www.genepattern.org/modules/ docs/ssGSEAProjection/4#gsc.tab=0 WashU Epigenome Browser Li et al.58 https://epigenomegateway.wustl.edu/ browser/RRID:SCR_006208 Elysium Lachmann et al.59 https://maayanlab.cloud/cloudalignment/ elysium.html Morpheus Broad Institute https://software.broadinstitute.org/morpheus RRID:SCR_014975 Cytoscape 3.10.2 – http://apps.cytoscape.org/apps/bingo RRID:SCR_003032 Synergy finder Ianeviski et al.60 https://synergyfinder.fimm.fi/ Bowtie v2.3.1 Langmead and Salzberg et al.61 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml RRID:SCR_016368 MACS v1.4.2 Zhang et al.62 http://liulab.dfci.harvard.edu/MACS/ RRID:SCR_013291 Adobe Illustrator Adobe https://www.adobe.com/nl/RRID:SCR_010279 JBrowse2 JBrowse https://jbrowse.org/jb2/RRID:SCR_001004 Connectivity Map – Clue Broad Institute https://clue.io/RRID:SCR_015674 e4 Cell Reports Medicine 7, 102540, January 20, 2026 OPEN ACCESS were pre-stimulated with StemlineII medium (SigmaAldrich; #S0192), 1% penicillin/streptomycin (PS) supplemented with SCF (255-SC, Novus Biologicals), FLT3 ligand (FLT3-L, Amgen) and N-plate (TPO) (Amgen) (all 100 ng/mL). .. PBMSC CD34+ cells were pre-stimulated with StemlineII, 1% PS, 20% fetal bovine serum (FBS) along with SCF, FLT3-L, N-plate (all 100 ng/mL) and IL-3 (Sandoz) and IL-6 (both 20 ng/mL).



    Similar Products

    algorithms graphpad prism  (Tree Star Inc)
    86
    Tree Star Inc algorithms graphpad prism
    Algorithms Graphpad Prism, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/flowjo10/pm42268710-553-201-212
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms prism 8 0 graphpad  (Deepmind Technologies Ltd)
    86
    Deepmind Technologies Ltd algorithms prism 8 0 graphpad
    Algorithms Prism 8 0 Graphpad, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm42228568-188-165-178
    Average 86 stars, based on 1 article reviews
    algorithms prism 8 0 graphpad - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism version 9 5 1 graphpad  (Tree Star Inc)
    86
    Tree Star Inc algorithms graphpad prism version 9 5 1 graphpad
    Algorithms Graphpad Prism Version 9 5 1 Graphpad, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/flowjo10/pm42166330-192-5-19
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism version 9 5 1 graphpad - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism dotmatics  (Dotmatics Limited)
    86
    Dotmatics Limited algorithms graphpad prism dotmatics
    Algorithms Graphpad Prism Dotmatics, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/graphpad+prism/pm41903141-212-194-197
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism dotmatics - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 10 4 1 graphpad software  (Deepmind Technologies Ltd)
    86
    Deepmind Technologies Ltd algorithms graphpad prism 10 4 1 graphpad software
    Algorithms Graphpad Prism 10 4 1 Graphpad Software, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm41903133-211-97-117
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 10 4 1 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 10 3 1 graphpad software  (Deepmind Technologies Ltd)
    86
    Deepmind Technologies Ltd algorithms graphpad prism 10 3 1 graphpad software
    Algorithms Graphpad Prism 10 3 1 Graphpad Software, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm41824449-733-235-256
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 10 3 1 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms prism graphpad software  (Biognosys)
    86
    Biognosys algorithms prism graphpad software
    Algorithms Prism Graphpad Software, supplied by Biognosys, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/algorithms+graphpad+prism+software/pm41747732-295-59-89
    Average 86 stars, based on 1 article reviews
    algorithms prism graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms flowjo software 10 10 tree star rrid scr 008520 graphpad prism 10 graphpad software  (Tree Star Inc)
    86
    Tree Star Inc algorithms flowjo software 10 10 tree star rrid scr 008520 graphpad prism 10 graphpad software
    Algorithms Flowjo Software 10 10 Tree Star Rrid Scr 008520 Graphpad Prism 10 Graphpad Software, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/flowjo10/pm41734064-296-7-11
    Average 86 stars, based on 1 article reviews
    algorithms flowjo software 10 10 tree star rrid scr 008520 graphpad prism 10 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 9 4 158 graphpad software  (Stratedigm Inc)
    86
    Stratedigm Inc algorithms graphpad prism 9 4 158 graphpad software
    Algorithms Graphpad Prism 9 4 158 Graphpad Software, supplied by Stratedigm Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/pm41632570-215-151-185
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 9 4 158 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms nis element nikon n a prism graphpad n a matlab mathworks n a e1 cell reports 6  (Addgene inc)
    94
    Addgene inc algorithms nis element nikon n a prism graphpad n a matlab mathworks n a e1 cell reports 6
    Algorithms Nis Element Nikon N A Prism Graphpad N A Matlab Mathworks N A E1 Cell Reports 6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/5W9Q+(MBD1)+(Plasmid+%23101265)/pm41592533-317-89-86
    Average 94 stars, based on 1 article reviews
    algorithms nis element nikon n a prism graphpad n a matlab mathworks n a e1 cell reports 6 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results